Skip to main content
Download PDF

Immunoglobulin gene loci structure and diversity of raccoon dog (Nyctereutes procyonoides)

BMC Genomics volume 26, Article number: 424 (2025) Cite this article

Abstract

In this study, we analyzed the loci structure of raccoon dog genes using a comparative genomics approach. We investigated the mechanism of expression diversity and its preference using the Next-generation sequencing. The results indicated that the raccoon dog gene loci structure were similar to that of most mammals, with a relative abundance of V(D)J genes, which ensures its expression diversity. We identified the following potentially functional genes: 7 VH genes, 6 Vκ genes, 23 Vλ genes, 24 DH genes, 5 JH genes, 4 Jκ genes, and 6 Jλ genes, arranged in a manner similar to that of other mammals. Analysis of the raccoon dog expression diversity mechanism showed that raccoon dog have a strong preference for the use of V genes, and the same was true for DH genes. The main modes of expression diversity in raccoon dog were V(D)J recombination and somatic hypermutation, in which the high mutation region of somatic hypermutation was not only concentrated in the CDR region, but also has a high mutation in the FR region, and the main types of somatic hypermutation were G > A, C > T, T > C, and A > G. Interestingly, we compared the expression differences between normal and diseased raccoon dogs, and the results showed that there were significant differences in the expression of the same gene (P < 0.05), whereas there were no significant differences in the types of gene expression, gene utilization preference, V(D)J recombination, and somatic hypermutation mutation types. In summary, we have described the IgH and IgL gene loci structure of raccoon dog, mapped the gene loci, and analyzed the mechanism of expression diversity and its preference using PE300 Next-generation sequencing. The results of this study could provide a theoretical basis for an in-depth understanding of raccoon dog immunoglobulins, and provide theoretical references for raccoon dog disease-resistant breeding.

Peer Review reports

Introduction

Raccoon Dog (Nyctereutes procyonoides) has a long history of domestication in China, with a large-scale farming industry and strong adaptability to various environments, including plains, hills, and some mountainous areas spanning the sub-cooling to the subtropical region. The raccoon dog is a promising animal model in the class Mammalia, order Carnivora, family Canidae, genus Nyctereutes [1, 2]. In China, raccoon dogs are widely raised as one of the most important fur-bearing economic animals [3]. Raccoon dogs are omnivores [4], they are small and fat, with disproportionately short legs and a fox-like appearance. Due to these characteristics, raccoon dogs have learned to climb trees and swim, and have become omnivorous in their diet [5]. Lan et al. found that raccoon dogs may have a diverse immune system and that most of the positively selected genes that raccoon dog have evolved are related to immunity [6]. The structure of the raccoon dog Immunoglobulin (Ig) loci and the mechanisms of diversity have not been described so far.

Immunoglobulins (Igs) are important components of the adaptive immune system and first appeared with the appearance of jawed vertebrates about 500 million years ago [7, 8]. The classical Ig monomer molecule is a symmetric structure consisting of two identical heavy chains (H chains) of high relative molecular mass and two identical light chains (L chains) of low relative molecular mass, which are connected by disulfide bonds, giving the appearance of a “Y” structure [9]. In general, a structural domain located at the N-terminal end of the heavy and light chains, whose amino acid sequence and composition varies considerably from antibody to antibody, is known as the variable region of immunoglobulins (V region), denoted VH and VL, respectively. The remaining portion is the constant region of immunoglobulin (C region), denoted CH and CL, respectively. The V region consists of four framework regions (FRs) and three complementary determining regions (CDRs) arranged in a staggered fashion arrangement and is mainly responsible for recognising and binding antigens [10, 11].

B cells are activated upon binding to foreign antigens, leading to B cell proliferation and differentiation into antibody-producing plasma cells or memory cells [12]. Mature initial B cells express IgD and IgM, whereas memory B cells express IgM, IgA, IgG or IgE [13, 14]. Immunoglobulins (Ig) play an important role in vivo as major effector molecules in the adaptive immune system, mainly in neutralisation, modulation and complement activation [15]. However, the organism’s own limited Ig classes are insufficient to cope with the invasion of thousands of antigens in nature [16]. The recombination between Ig gene segments determines an individual’s naïve antibody repertoire and, consequently, (auto)antigen recognition. Therefore, the organism has evolved several mechanisms, such as V(D)J recombination, gene conversion (GCV), somatic hypermutation (SHM), and class switch recombination (CSR), to enrich Ig diversity [17,18,19,20]. Recent studies have shown that the greater the DNA sequence flexibility in the mesoscale, the more favorable it is to bind the positively charged regions on the surface of the AID, which in turn favors the occurrence of SHM [21].

Understanding the natural mechanisms of immunity against infection and how vaccination, biosecurity, nutrition, livestock and management practices can be used to maintain and enhance immune protection is essential [22]. Recombination between segments of the Ig gene determines an individual’s initial antibody pool, and hence (auto)antigen recognition [23]. The research on the genetic diversity of immunoglobulin genes could be used to provide a favourable reference for the preparation of monoclonal antibodies or vaccine design [24, 25]. For example, using SHM data, antibody sequences could be optimised for somatic high affinity. A technique for generating antigen-specific antibodies and maturing their affinity has previously been developed by converting the mechanism of chicken gene conversion through the accumulation of SHM in the immunoglobulin locus using XRCC2 knockout chicken DT40 cells [26]. They accumulated SHM in cloned functional IgV with no specificity for the antigen and then sorted the clones with increased affinity for the antigen. The clones generated by the iterative culture and sorting process showed high affinity for the antigen. Other laboratories have also reported affinity maturation using XRCC3 hemizygous knockout DT40 cells [27]. In addition, some researchers have also humanised animal-derived antibodies by altering the amino acid sequence of non-human animal-derived antibodies in order to increase their similarity to human antibodies [28]. For example, the antibody produced by chicken DT40 cells is chicken IgM, and therefore the antibodies obtained need to be humanised for application to human disease treatment. A cell-based library was constructed to isolate human IgG1 antibodies (human ADLib system) by engineering chicken DT40 cells, replacing exons of the chicken immunoglobulin gene with exons of the human immunoglobulin gene, and inserting designed human variable gene sequences as pseudogenes upstream [29].

Recent studies have elucidated the structure of mammalian Ig loci and characterized their expression diversity. Wu et al. found that yak IgH is located on chromosome 17 and contains 42 VH gene fragments, 55 DH gene fragments, and 3 JH gene fragments, yak Igκ is located on chromosome 9 and contains 23 Vκ gene fragments, and 5 Jκ gene fragments, and yak Igλ is located on chromosome 16, containing 45 Vλ gene fragments, and 9 Jλ gene fragments [30]. Goat IgH contains 8 VH genes, 3 DH genes and 6 JH genes, and only 3 VH genes and 3 DH genes and 2 JH genes were involved in the VDJ recombination [31]. Studies of goat IgL have shown that the λ light chain variable region gene loci contain at least 35 Vλ gene fragments divided into 7 potentially functional genes, one open reading frame (ORF) and 27 pseudogene fragments. Additionally, 11 Vκ gene fragments in the κ chain were categorized into five potentially functional genes, two ORFs, and four pseudogene fragments, all of which were classified into three gene families based on their similarity. Based on the nucleotide similarity, all sequences could be categorized into three gene families. Three functional Jκs were located upstream of a Cκ. λ-chain gene loci were arranged according to Vλ(35)-Jλ3-Cλ3-Jλ2-Cλ1-Jλ1-Cλ2, and κ-chain gene loci were arranged according to Vκ(35)-Jκ(3)-Cκ. In terms of expression levels, there was a preference for the utilization of V genes by light chain VJ recombination in goats, with Vλ2 (26.23%) and Vλ3 (73.11%) being expressed predominantly in the λ chain, and Vκ2 (52.07%) and Vκ4 (46.15%) in the κ chain. Regarding the number of N + P nucleotides and the length of CDR3 amino acids, the λ chain has richer linkage diversity than the κ chain [32]. Emerging evidence suggests that mammalian Ig germline variation impacts humoral immune responses associated with vaccination, infection, and autoimmunity from the molecular level of epitope specificity, up to profound changes in the architecture of antibody repertoires [23]. In a recent study, researchers fully annotated the Ig loci in dogs, found a total of nine JC paired IGLs, and identified 162 IGLV genes, 19 IGKV genes, as well as five IGKJ genes and one IGKC gene, and, notably, three new IGHJ genes based on the predecessor [33].

The structure of the raccoon dog Ig loci and the mechanisms of diversity have not been described so far. Characterizing these mechanisms may be important for the design raccoon dog of vaccines and other therapies. Therefore, the study of raccoon dog Igs are of great theoretical importance and applied value. In this regard, the present study was conducted to characterize the structure of the raccoon dog Ig gene loci and its expression diversity by using comparative genomics and PE300 next-generation sequencing (NGS), to provide a theoretical basis for breeding raccoon dogs for disease resistance and conservation of genetic resources.

Materials and methods

All experimental procedures were carried out according to the Regulations on the Administration of Affairs Concerning Experimental Animals approved by the State Council of the People’s Republic of China. The research was approved by the Institutional Animal Care and Use Committee of Northwest A&F University (No: NWAFAC231219).

Animals, RNA isolations

Five raccoon dogs (10 months of age) were obtained from the breeding farm of the Institute of Specialty Products, Chinese Academy of Agricultural Sciences (Changchun, Jilin, China), vaccinated with the same vaccines (Inactivated mink microvirus enteritis vaccine, MEVB strain; Mink live distemper vaccine, CDV3-CL strain) and kept under the same rearing environment. Samples 1–3 were normal adult raccoon dogs, while samples 4 and 5 were adult raccoon dogs with encephalitis (Early loss of appetite, elevated body temperature, agitation, irregular walking or running back and forth in the nest, followed by epileptic symptoms, died after half a month, a veterinarian at the farm diagnosed the illness as encephalitis). We bled raccoon dogs to death under deep anesthesia after anesthetizing them with the inhalant anesthetic isoflurane. The spleens of the five raccoon dogs were collected (the spleen is the site of settlement of mature lymphocytes, of which B cells account for about 60% of the total number of splenic lymphocytes, and the spleen is also the main site of the primary immune response to blood-borne antibodies), preserved in liquid nitrogen and subsequently stored at -80 ℃. Spleen RNA was extracted by the Trizol (TaKaRa, Dalian, China) method [34]. The RNA concentration and quality were shown in Supplementary Table 1.

Analysis of the raccoon dog VH, VL and Vk segments

In this experiment, based on the raccoon dog (Nyctereutes procyonoides, taxid: 34880) genome data (NYPRO_anot_genome reference assembly GCF_905146905.1-RS_2023_04) published in the NCBI (http://www.ncbi.nlm.nih.gov, last login: 2023/10/29) database [35], we downloaded the sequences of human, mouse, pig, bovine, and dog VH, DH, JH, Vλ, Jλ, Vκ, Jκ genes and the constant region µ、δ、α、γ、ε、λ、κ sequences (CDS sequences), which were published in NCBI and IMGT (https://www.imgt.org/, last login: 2023/10/29). We use the above template sequence to search for VH, DH, JH, Vλ, Jλ, Vκ, Jκ, µ, δ, α, γ, ε, λ, and κ gene locations in the raccoon dog genome by BLAST (Parameter setting: Enter the V or C gene sequence numbers of other species, select BLASTN tool, set the genome version to be searched, and finally select Highly similar sequences (megablast), and keep other parameters as default.) and used the FUZZNUC website (www-archbac.u-psud.fr/genomics/patternSearch.html, last login: 2023/10/30) to search for potential DH genes (Supplementary Table 2), JH genes, Jκ genes and Jλ genes by entering the classical RSS (Conservative amino acids + RSS), which allows for five base mismatches to retrieve RSS sequences conforming to the 12/23 rule (Parameter settings: input RSS sequence, import the corresponding genome sequence downloaded from NCBI (fasta format), select nucl pattern X nucl sequence, allow 5 base mismatches, and keep other parameters as default). The V genes from the above comparison were identified according to the international ImMunoGeneTics information system® (IMGT) rules and categorized into potentially functional V genes, pseudogenes and open reading frames [36,37,38]. All genes sought above were named according to their relative position on the genome. Finally, we mapped immunoglobulin IgH, Igλ, and Igκ gene loci maps were constructed based on the positions of all retrieved genes.

Phylogenetic analysis

All VH gene fragments of raccoon dog were selected and analyzed for the similarity between their nucleotide sequences using the DNAMAN 6.0 software (First enter the sequence that needs to be aligned, select Sequence-Aligment-Multiple alignment sequence-DNA for multiple sequence comparison, then select Fast Alignment, and keep other options as default). We classify sequences with nucleotide identity greater than 75% into the same gene family, sequences with less than 70% identity into different gene families, and sequences with identity between 70 and 75% classified according to actual conditions. MEGA11.0 (First enter the FASTA format sequence, select Align-Align by clustalw (codons), then select PHYLOGENY-NEIGHBOR-JOINING, and keep other options as default.) software was used to analyze the nucleotide identity of the FR1 to FR3 regions of raccoon dog V gene with those of Homo sapiens, Mus musculus, Bos taurus, O.aries, Sus scrofa, Canis lupus familiaris and so on. In addition to the potentially functional V genes and ORF of raccoon dogs, the additional species reference sequences are in Supplementary Material 1.

Cloning of the expressed raccoon dog IgH, IgL and Igk chain genes by 5’RACE PCR and sequencing

cDNA synthesis was performed using the 5’ RACE kit (TaKaRa, Dalian, China) with Gene-Specific Primers (GSP): IgHR: TGATGAGGGGGAAGAGGTTTGGA, IgκR: ACAAATAGACGGCTGGCTGGGCA, IgλR: GAGGGCGGGAAGAGTGTGACCGA, and universal primer (IgHF/IgκF/IgλF): AAGCAGTGGTATCAACGCAGAGT. PCR amplification using high-fidelity enzymes in the SMARTer® RACE 5’/3’ Kit (Takara, Dalian, China). The PCR amplification program was: 5 cycles: 94℃ 30 s, 72℃ 3 min; 5 cycles: 94℃ 30 s, 70℃ 30 s, 72℃ 3 min; 25 cycles, 94 °C 30 s, 68 °C 30 s, 72 °C 3 min. 1.5% agarose gel electrophoresis was performed for 30 min to obtain the target bands. The PCR products were subjected to Sanger sequencing to confirm the correctness of the bands. The correct product was then sent to Sangon Biotech (Shanghai, China) Co, Lted for PE300 bipartite sequencing to obtain 300 bp bipartite sequencing reads sequences. The total number of reads we obtained were as follows (Supplementary Table 3).

V(D)J combinatorial diversity analysis, SHM statistics and CDR3 calculations

The sequences of all reads obtained by sequencing were assembled (Sangon Biotech, Shanghai, China) and imported into International ImMunoGeneTics Information System (IMGT), and the data were analyzed using the high-throughput data analysis tool IMGT/HighV-QUEST (https://www.imgt.org/HighV-QUEST/, last login: 2024/09/01) [39, 40]. Subsequently, we performed data QC to get clean data for the next step of analysis. The conditions of the QC were as follows: delete sequences with sequence lengths of less than 400 bp, containing no amplification primers. To facilitate the distinction between germline genes and recombinant expressed gene sequences, we categorized all reads by family according to the naming rules of IMGT and named them IGHV1, IGHV2, IGHV3, IGHV4 and so on, with κ and λ strands named similarly to H strands (IGKVn/IGLVn). VDJ usage was then analyzed using the online website https://www.omicstudio.cn/tool. For CDR3 analysis, we first counted the sequence information of each reads CDR3, calculated the CDR3 sequence length of each reads, and analyzed the distribution of CDR3 sequence length of each sample. Immediately after that, we counted the number of N and P nucleotide insertions for each reads and analyzed the distribution of N and P nucleotides for each sample. Finally, we used the Clustalw (all parameters were software defaults) tool of MEGA11.0 software to align sequenced reads to germline gene sequences, and subsequently used EXCEL to count the SHM mutation positions, mutation types and their distribution patterns.

Statistical analysis

GraphPad Prism 9.5 was used for statistical analysis and plotting. Mega11.0 and iTOL (https://itol.embl.de/login.cgi) for phylogenetic analysis, and tvBOT for tree file visualization (https://www.chiplot.online/tvbot.html) [41, 42].

Results

Structure of the genomic organization and phylogenetic analysis of raccoon dog IgH

By BLAST, we found that raccoon dog IgH was distributed in 12 genomic scaffolds according to the IMGT rule, and 78 VH genes were identified, of which 7 were V genes with potential functions. We also found 24 DH genes and 5 JH genes according to the “12–23 rule” for RSS, and identified one µ gene, one δ gene, one γ gene, one ε gene and one α gene. Interestingly, all the DH genes, JH genes, and constant region genes were located on the same genome segment (Fig. 1A). The raccoon dog VH genes can be categorized into three families (Fig. 1C), and their potentially functional genes were present in all three families. Analysis of all DH genes revealed that their length varied from 18 to 45 bp, notably, all 24 DH genes can be 6 unique genes and the rest were duplicates of these 6 genes (Supplementary Table 2). Analysis of the five JH genes revealed that all of them had the conserved amino acid “WGXG”, indicating that they belonged to the potentially functional JH genes, among which the conserved sequence of JH was “WGHG” (Fig. 1B). The nucleotide identity of the FR1 ~ FR3 regions of raccoon dog VH gene with Homo sapiens, Mus musculus, Bos taurus, O.aries, and Canis lupus familiaris was analyzed by MEGA11.0 software, and it was found that it was more closely related to canine than to other mammals, probably because raccoon dog and domestic dog belong to the same family of canines, they have retained many similar genetic traits in their evolution(Fig. 1D).

Fig. 1
figure 1

Structure of the Genomic Organization and Phylogenetic Analysis of Raccoon Dog IgH A:Schematic structure of thegenomic organization of Raccoon Dog IgH; B: The structural variation of Raccoon Dog JH; C: The phylogenetic tree of Raccoon Dog VH; D: The phylogenetic tree of VH in Raccoon Dog and representative vertebrate species

Full size image

Analysis of raccoon dog VH, DH and JH usage

In order to analyze the use of VDJ genes after raccoon dog recombination, we categorized and named all valid reads obtained by sequencing according to IMGT-subgroup, as shown in Fig. 2. Analysis of the frequency of VH gene use revealed that the more used was IGHV3, with a usage rate of 76.4-94.9%, followed by IGHV4 and IGHV1 (Fig. 2A-B). The normal and diseased groups were the same in terms of the types of VH genes used, but the diseased group had a significantly higher utilization rate of IGHV3 than the normal group (P < 0.05), and a significantly lower utilization rate of IGHV4 than the normal group (P < 0.05). There were five main categories of DH genes, with the most frequently used being IGHD2 and IGHD4, with an average frequency of use of IGHV2 amounting to more than 30%, and the types of DH genes used in the diseased and normal groups were consistent, differing only in the frequency of use (Fig. 2C-D). Consistent with the situation of VH and DH genes, the use of raccoon dog JH genes also had a clear preference, and the most frequently used was IGHJ4, with a starting utilization rate of more than 60% in the normal group and more than 53% in the diseased group. In terms of the type of use, there was no significant difference between the diseased and normal groups (Fig. 2E-F).

Fig. 2
figure 2

Analysis of Raccoon Dog VH, DH and JH usage. A&B: Expression of the Raccoon Dog VH; C&D: Expression of the Raccoon Dog DH; E&F: Expression of the Raccoon Dog JH

Full size image

Recombination diversity and VDJ junctions diversity of raccoon dog IgH

Figure 3A-B demonstrated the VDJ recombination diversity of raccoon dog Ig heavy chains. The analysis revealed that the most expressed combinations of sample 1 were IGHV3-IGHD4-IGHJ4 (19.4%) and IGHV3-IGHD2-IGHJ4 (15.3%), the most expressed combinations of sample 2 were IGHV3-IGHD2-IGHJ4 (19.0%) and IGHV3-IGHD4-IGHJ4 (16.9%) and the most expressed combinations of sample 3 were IGHV3-IGHD2-IGHJ4 (18.4%) and IGHV3-IGHD4-IGHJ4 (13.7%). The type of expression in the diseased and normal groups was consistent. The most expressed combinations in sample 4 and 5 were also IGHV3-IGHD2-IGHJ4 and IGHV3-IGHD4-IGHJ4, but in both combinations in the diseased group was lower than the normal group in terms of the usage rate of these combinations. This implied that the diseased group expressed more combination types to better respond to antigenic stimuli.

Fig. 3
figure 3

Recombination diversity and linkage diversity of Raccoon Dog IgH VDJ. A: The sankey diagram of VDJ recombination in normal Raccoon Dog IgH; B: The sankey diagram of VDJ recombination in disease Raccoon Dog IgH; C: the random deletionnucleotides of IGHV and IGHJ gene in Raccoon Dog IgH, N/P nucleotide insertions

Full size image

In addition, the length of CDR3 during VDJ recombination is one of the important indicators of linkage diversity, which could enrich Ig linkage diversity, and the longer the CDR3, the more spatial conformations it could provide. As shown in Fig. 3C, the random deletion of VH genes during the linkage process was concentrated at 0 bp, 3 bp, and 6 bp, while the random deletion of JH genes was mainly concentrated at 2 bp, 5 bp, 8 bp and 11 bp. The length of DH was mainly concentrated at 6–15 bp, and could reach up to 31 bp, and JH genes were mainly concentrated at 6 bp, 12 bp, and 15 bp. In addition, the insertion of N and P nucleotides, also is one of the main contributors to the length of CDR3, raccoon dog heavy chain N, P could be divided into insertion between V-D and insertion between DJ, in which P1 + N1 + P2 were mainly distributed in 0–13 bp, while P3 + N2 + P4 were mostly 0–6 bp. The length of raccoon dog CDR3 was distributed at a high frequency of 30–42 bp, with an average length of 35.00 bp in the healthy group and 35.80 bp in the diseased group, and the length of CDR3H can be the longest up to 90 bp. To further assess the amino acid composition of CDR3H, we analyzed the overall frequency of amino acid use of raccoon dog CDR3H between 107 and 114 in the two groups (Fig. 4). We found that there was no significant difference between normal and diseased groups, which also showed similar characteristics in their amino acid composition. The frequency of use of aromatic amino acids was higher than that of other amino acids (Fig. 4C).

Fig. 4
figure 4

Frequency of various amino acids used in CDR3H of Raccoon Dog. A: Frequency of hydrophobic amino acids in CDR3H of Raccoon Dog; B: Frequency of small molecular functional group amino acids in CDR3H of Raccoon Dog; C: Frequency of use of aromatic amino acids in CDR3H of Raccoon Dog; D: Frequency of use of charged amino acids in CDR3H of Raccoon Dog

Full size image

SHM analysis of VH (FR1-FR3)

We analyzed the pattern of SHM base distribution in the FR1-FR3 region of raccoon dog expression and the types of SHM mutations. Since the IMGT database lacks data on germline genes in raccoon dog, we analyzed raccoon dog SHM mutations using germline genes searched in the genome compared with reads obtained by sequencing. In addition, there was a high degree of nucleotide similarity in the same family of germline sequences, so we only analyzed the distribution of mutations in the FR1-FR3 region of the VH1, VH2, VH3, and VH6 genes, as shown in Fig. 5A-D. The results showed that the mutations in all V genes were mainly concentrated in the CDR region (CDR1 and CDR2), in addition to that, we found that the end of the FR2 region and a few positions of FR1 and FR3 (VH6) also had a part of the high-frequency mutation regions, which indicated that SHM could occur at a high frequency outside the high mutation regions. Next, we counted the mutation types of SHM, and we found that the mutation types of all samples were clustered in G > A, C > T, T > C, and A > G, with the mutations of G > A and A > G dominating, and the mutation types of the diseased and healthy groups behaved consistently (Fig. 5E-J).

Fig. 5
figure 5

The somatic hypermutation (SHM) of Raccoon Dog IgH. A-D: The distribution of SHM in Raccoon Dog IgH; E-J The base mutation types of SHM in Raccoon Dog IgH

Full size image

Structure of the genomic organization and phylogenetic analysis of raccoon dog Igκ

By BLAST comparison, according to the IMGT rule, we found that raccoon dog Igκ was located on the same fragment, with a full length of about 270 kb, and there were 22 Vκ genes in total, of which 6 Vκ genes were potentially functional gene, of which Vκ6 was inverted, and the rest of 16 Vκ fragments were pseudogenes, including some structurally incomplete pseudogenes (Fig. 6A), and the 4 Jκ genes were all potentially functional, and all of them had the FGXG conserved structures (Fig. 6B). In addition, we found a Cκ gene with a full length of about 320 bp (Fig. 6A). The nucleotide identity of the FR1 ~ FR3 regions of raccoon dog Vκ genes with human, mouse, dog, cow, sheep, horse, frog, chicken, African Java, zebrafish and nurse shark was analyzed using MEGA11.0 software, and like IgH, the Vκ gene was more proximate to the Canis lupus familiaris (Fig. 6C). Using the phylogenetic tree constructed by the Neighbor-Joining (NJ) algorithm in MEGA 11.0, raccoon dog Vκ genes were categorized into three families (Fig. 6D).

Fig. 6
figure 6

Structure of the Genomic Organization and Phylogenetic Analysis of Raccoon Dog Igκ. A:Schematic structure of thegenomic organization of Raccoon Dog Igκ; B: The structural variation of Raccoon Dog Jκ; C: The phylogenetic tree of Vκ in Raccoon Dog and representative vertebrate species. D: The phylogenetic tree of Raccoon Dog Vκ

Full size image

Analysis of raccoon dog Vκ and Jκ usage

The analysis of Vκ use revealed that the most used in both normal and diseased groups were IGKV2 and IGKV4. The utilization rate of IGKV2 in the normal group was more than 72.4%, with a maximum of 85%. However, in the diseased group, the V gene expression in the two samples was different, sample 4 expressed the most was IGKV4 (68%) and sample 5 expressed the most was IGKV2 (73%), which was significantly lower than that of the normal group (P < 0.05), and the utilization rate of IGKV4 in the diseased group was significantly higher than that of the normal group (P < 0.05) (Fig. 7A-B). The use of the Jκ gene was shown in Fig. 7C-D, with a strong preference for raccoon dog IGKJ1, with an average utilization rate of more than 78% in each of the five samples, and consistent expression in the diseased and normal groups.

Fig. 7
figure 7

Analysis of raccoon dog Vκ and Jκ usage. A-B: Expression of the Raccoon Dog IGKV; C-D: Expression of the Raccoon Dog Jκ

Full size image

Recombination diversity and VJ junction diversity of raccoon dog Igκ

To analyze the VJ recombination of Igκ, we plotted a Sankey diagram based on its recombination, as shown in Fig. 8A-B. The analysis showed that the combinations with higher expression in sample 1 were IGKV2-IGKJ1 (66.3%) and IGKV4-IGKJ1 (11.9%), the combinations with higher expression in sample 2 were also IGKV2-IGKJ1 (60.3%) and IGKV4-IGKJ1 (17.7%), and the combinations with highest expression in sample 3 were IGKV2-IGKJ1 (50.1%) and IGKV2-IGKJ5 (19.0%), whereas the highest expressed combinations in sample 4 were IGKV4-IGKJ1 (65.3%) and IGKV2-IGKJ1 (19.9%), and the higher expressed combinations in sample 5 were IGKV2-IGKJ1 (54.5%) and IGKV3-IGKJ1 (17.7%). It can be seen that the type of expression after recombination was the same in the diseased group compared with the normal group, but the ratio of expression in the diseased group in the main type of expression was significantly different from the normal group. The analysis of the CDR3κ length diversity showed that random deletions of the Vκ genes were mainly concentrated in the range of 0–3 bp, and that Jκ gene’s random deletions were similarly concentrated at 0–3 bp (Fig. 8C). In addition, the insertion of N and P nucleotides was also an important factor affecting CDR3, and the results showed that the insertion of N and P nucleotides were both 0 bp at most, followed by 1–2 bp, indicating that the CDR3 length of raccoon dog Igκ was less affected by the insertion of N and P nucleotides (Fig. 8C). Subsequently, we further analyzed the amino acid composition of CDR3κ, which was used similarly in the normal and diseased groups with no significant difference (Fig. 9), and interestingly, cysteine was used extremely infrequently (Fig. 9B).

Fig. 8
figure 8

Recombination diversity and VJ junction diversity of Raccoon Dog Igκ. A: The sankey diagram of VJ recombination in normal Raccoon Dog Igκ; B: The sankey diagram of VJ recombination in disease Raccoon Dog Igκ; C: the random deletionnucleotides of Vκ and Jκ gene in Raccoon Dog Igκ, N/P nucleotide insertions

Full size image
Fig. 9
figure 9

Frequency of various amino acids used in CDR3κ of Raccoon Dog. A: Frequency of hydrophobic amino acids in CDR3κ of Raccoon Dog; B: Frequency of small molecular functional group amino acids in CDR3κ of Raccoon Dog; C: Frequency of use of aromatic amino acids in CDR3κ of Raccoon Dog; D: Frequency of use of charged amino acids in CDR3κ of Raccoon Dog

Full size image

SHM analysis of Vκ (FR1-FR3)

Further, we analyzed the distribution pattern of SHM mutations in the Vκ gene, and because of the high nucleotide similarity in the same family of germline genes, we selected Vκ1, Vκ3 and Vκ5 to analyze their mutations. The analysis revealed that the SHM mutation regions were not only concentrated in the CDR region, but also high-frequency mutation regions appeared in the FR2 region (Fig. 10B). Notably, higher-frequency mutations were also seen in some regions of FR1 and FR3 (Fig. 10A-C). In terms of mutation types, the mutation types of Igκ were mainly G > T and A > G mutations were the most frequent, and there was no significant difference between the diseased and healthy groups (Fig. 10D-I).

Fig. 10
figure 10

The somatic hypermutation (SHM) of Raccoon Dog Igκ. A-C: The distribution of SHM in Raccoon Dog Igκ; D-I: The base mutation types of SHM in Raccoon Dog Igκ

Full size image

Structure of the genomic organization and phylogenetic analysis of raccoon dog Igλ

After BLAST comparison, we found that the V genes of Igλ were mainly distributed on four genomic segments under the condition of satisfying the rules of IMGT annotation of V genes. We compared a total of 71 Vλ genes, of which 23 were potentially functional genes, and the remaining 48 Vλs were pseudogenes, including some structurally incomplete Vλ genes (Fig. 11A). We also identified 6 Jλ genes, all of which were potentially functional genes, and interestingly, 6 Cλ genes, which were arranged in an alternating pattern of ‘Jλ-Cλ-Jλ-Cλ’, however, between the Jλ-Cλ pairs, some Vλ gene fragments were present, which may resulted from genomic misassembly (Fig. 11A). Six Jλ genes contain conserved structures of “FGNG”, and all of them were potentially functional J genes (Fig. 11B). Based on the nucleotide similarity of more than 75%, the Vλ genes could be categorized into three families (Fig. 11C). The nucleotide identity of the FR1 ~ FR3 regions of raccoon dog Vλ gene with Homo sapiens, Mus musculus, Canis lupus familiaris, Bos taurus, Ovis aries, Anas platyrhynchos, Xenopus laevis, and Meleagris gallopavo was analyzed with MEGA 11.0 software, and it was found to be more closely related to Mus musculus and Homo sapiens, followed by mammals such as Canis lupus familiaris (Fig. 11D).

Fig. 11
figure 11

Structure of the Genomic Organization and Phylogenetic Analysis of Raccoon Dog Igλ. A:Schematic structure of thegenomic organization of Raccoon Dog Igλ; B: The structural variation of Raccoon Dog Jλ; C: The phylogenetic tree of Raccoon Dog Vλ. D: The phylogenetic tree of Vλ in Raccoon Dog and representative vertebrate species

Full size image

Analysis of raccoon dog Vλ and Jλ usage

In order to understand the use of the V and J genes of raccoon dog Igλ gene, we counted the V and J genes expressed in all samples. The results showed that the V gene type with the highest percentage of use in all samples was IGLV1, with a usage rate of 58.1-77.9%, and the expression rate in the diseased group was higher than that in the normal group (P < 0.05) (Fig. 12A-B). Analysis of the usage of the Jλ gene revealed that raccoon dogs likewise had a strong preference, as shown in Fig. 12C-D. The highest frequencies of use were IGLJ6 (> 27.1%) and IGLJ7 (> 14.5%), and the diseased group was significantly higher than the normal group in the utilization of these two J genes (P < 0.05).

Fig. 12
figure 12

Analysis of Raccoon Dog Vλ and Jλ usage. A-B: The usage of the Raccoon Dog Vλ; C-D: The usage of the Raccoon Dog Jλ

Full size image

Recombination diversity and VJ junctions diversity of raccoon dog Igλ

Analysis of the VJ recombination of Igλ revealed that the most expressed recombination types in samples 1–3 were consistent, both being IGLV1-IGLJ6 and IGLV1-IGLJ4. Among them, the utilization of IGLV1-IGLJ6 ranged from 19.2 to 20.6%, and that of IGLV1-IGLJ4 ranged from 11.8 to 16.1% (Fig. 13A). In contrast, in the diseased group, the most expressed in both Sample 4 and Sample 5 were IGLV1-IGLJ6 (25% and 33.1%) and IGLV1-IGLJ7 (12.3% and 19.9%) (Fig. 13B). While in the diseased group, the most expressed in both Sample 4 and Sample 5 were IGLV1-IGLJ6 (25% and 33.1%) and IGLV1-IGLJ7 (12.3% and 19.9%) (Fig. 13B). Random deletions of the V genes were predominantly distributed in the range of 0–3 bp, and the random deletion of the J gene showed the same pattern as the random deletion of the V gene. (Fig. 13C). Same as Igκ, the insertion of N/P nucleotides in Igλ was also most at 0 bp and a few at 1–2 bp, indicating that the insertion of NP nucleotides was not a major factor affecting CDR3λ (Fig. 13C). Further analysis of the amino acid composition of CDR3λ showed that there was also no significant difference between the healthy and diseased groups (Fig. 14). As with Igκ, cysteine was used very infrequently (Fig. 14B).

Fig. 13
figure 13

Recombination diversity and VJ junctions diversity of Raccoon Dog Igλ. A: The sankey diagram of VJ recombination in normal Raccoon Dog Igλ; B: The sankey diagram of VJ recombination in disease Raccoon Dog Igλ; C: the random deletionnucleotides of Vλ and J λgene in Raccoon Dog Igλ, N/P nucleotide insertions

Full size image
Fig. 14
figure 14

Frequency of various amino acids used in CDR3λ of Raccoon Dog. A: Frequency of hydrophobic amino acids in CDR3λ of Raccoon Dog; B: Frequency of small molecular functional group amino acids in CDR3λ of Raccoon Dog; C: Frequency of use of aromatic amino acids in CDR3λ of Raccoon Dog; D: Frequency of use of charged amino acids in CDR3λ of Raccoon Dog

Full size image

SHM analysis of Vλ (FR1-FR3)

As with the analysis of IgH and Igκ, we chose Vλ5, Vλ11, Vλ16, Vλ7 and Vλ23 as templates for statistical analysis of the distribution of SHM mutations in the FR1-FR3 regions of the sequenced sequences, as shown in Fig. 15A-E, the high-frequency mutation regions were mainly concentrated in the CDR region, but in Vλ11, Vλ16, Vλ17, the FR1 and FR2 regions also had more mutated regions, in addition, the FR3 region also showed high mutation frequency in a few positions. Analysis of the mutation types revealed that the mutation types were mainly G > A, C > T, T > C and A > G (Fig. 15F-K).

Fig. 15
figure 15

The somatic hypermutation (SHM) of Raccoon Dog Igλ. A-E: The distribution of SHM in Raccoon Dog Igλ; F-K: The base mutation types of SHM in Raccoon Dog Igλ

Full size image

Discussion

The raccoon dog is an important fur-bearing economic animal, and research on its immune system is crucial for vaccine design and other therapies. In this study, we conclusively constructed a structural map of the raccoon dog genome Ig gene loci. In addtion, we used high-throughput sequencing to analyse the reasons for the complexity of raccoon dog antibody repertoire, the preference for the use of V(D)J recombination and the association of SHM high-frequency mutation regions and types with the expression of raccoon dog Ig diversity. Together, these findings advance our understanding of raccoon dog Ig expression characteristics, which was crucial for linking the mechanisms of furbearer Ig expression diversity to their antibody design, and contributes to furbearer breeding and furbearer genetic resource conservation and utilization.

We first constructed a raccoon dog Ig gene loci map (Figs. 1A, 6A and 11A) by a comparative genomics approach using the published raccoon dog genome [35], searching for V genes, (D) genes, J genes, and constant region genes in the raccoon dog genome that conformed to the IMGT rule. Among them, the number of V genes were 7 VH, 6 Vκ, 23 Vλ, 24 DH genes (4 repeats of 6 unique genes), 5 JH genes, 4 Jκ genes, and 6 Jλ genes, which were located on the genome segments. Obviously, these genes did not represent all Ig gene fragments of raccoon dog. Because the assembly level of this genome (NYPRO_anot_genome reference assembly GCF_905146905.1-RS_2023_04) was scaffold, and the size of the genome was 2.4GB, with a total of 810 scaffolds, the Scaffold was 54 MB, Scaffold N50 was 53,959,811, Scaffold L50 was 17, and genome missing is 0.3% [35]. Although this version of the genome is already the highest-quality genome for raccoon dog, it is still parts missing or in separate scaffold. That’s maybe why the IgH loci were reversed. Similarly, we can’t exclude that there were duplications between different scaffolds, or some functional Ig genes were not discovered due to the limitation of the assembly level. It was worth noting that the high number of pseudogenes in IgH may not be true for raccoon dog IgH because a large proportion of these pseudogenes were due to structural incompleteness or sequence deletions, and the reason for this fact may be the indels were not polished well in the assembly, as mentioned above, there may be some parts missing. With the improvement of sequencing technology and genome assembly level, we believe that more raccoon dog Ig gene fragments will be discovered. Similar to most mammals, the order of IgH was (VH)n-(DH)n-(JH)n-C [7, 31]. In the gene loci structure of Igκ, we found only one Cκ gene, which was consistent with our previous study, while in the Igλ chain, Jλ-Cλ were arranged alternately, which was also similar to the arrangement in yak [30]. In all of our JH genes, there was a conserved sequence of “WGXG” and it ends with a wrench amino acid sequence of “TVSS”, which was also consistent with the characterization of conserved sequences in other species [16, 43,44,45,46].

Phylogenetic analyses showed that the three-stranded V gene of raccoon dog was highly homologous to humans and dog, this finding similar to current results on V gene nucleotide identity analysis [47, 48]. Immune repertoire captured through NGS has enabled deeper insight into B cell immunogenetics and paratope diversity [49, 50]. To evaluate potential Ig expression diversity of raccoon dogs, we established rearranged antibody expression gene repertoires based on NGS. In terms of the diversity of expression of raccoon dog Ig, our results suggested that VDJ recombination and SHM were the two most dominant mechanisms. In addition to the length of CDR3, which offers additional possibilities for diverse expression. Specifically, when V(D)J recombines, raccoon dog IgH, Igλ, and Igκ show a significant selective preference for the J gene, and similarly, IgH shows a significant preference for the DH gene (Figs. 3 and 8, and 13). This fact suggested that V(D)J recombination was an important component of Ig diversity. However, it is critical that random deletion of V and J genes and insertion of N and P nucleotides are the main factors constituting the length diversity of CDR3. Based on the above considerations, we counted the lengths of random deletion fragments at the 3’ end of the V gene and at the 5’ end of the J gene and the lengths of random insertion of N and P nucleotides [51]. Our results showed that the random deletions in the VH gene were concentrated at 0 bp, 3 bp, and 6 bp, this suggested that random deletion of most VH genes does not produce code-shifting mutations. Whereas the random deletions in the JH gene were mainly concentrated at 2 bp, 5 bp, and 11 bp. This result suggested that the contribution of raccoon dog 3’VH to the length of CDR3H was comparable to that of human (6.5 ± 1.7 bp), mouse (5.8 ± 1.7 bp), and domestic cow (8.8 ± 3.7 bp) [52,53,54]. SHM is an important mechanism for the generation of antibody diversity after recombination of V(D)J, and the amino acid changes induced by the mutation can improve the affinity of antibodies [17, 55]. Our results revealed that in addition to high-frequency mutations in the CDR region, there were also some high-frequency mutation regions in the FR region. Previous reports speculated possibly because some germ line VH genes exist in unsplicing genome fragments, resulting in an incomplete template library [30]. Here, we speculate that another possible reason was that mutations in the FR region may be more conserved. The SHM of raccoon dog IgH has a distinct characterization with the highest frequency of mutations from A to G and G to A, followed by mutations between A and T. These mutation patterns were the same as those in yak, cattle, mouse, zebrafish, etc. This result suggested that the mutation patterns of SHM were relatively conserved [54, 56, 57].

High-throughput sequencing technology has made it possible to increase the depth of detection of antibody repertoire to unprecedented depths, typically by sequencing cDNAs encoding variable structural domains of Igs [58, 59]. In this experiment, we used specific primers in conjunction with the MiSeq PE300 sequencing platform to perform high-throughput sequencing of PCR products from multiple raccoon dog cDNAs, which can well avoid the absence of low-frequency recombination compared to previous sanger sequencing to analyze Ig diversity, and at the same time yield a broader repertoire of Ig expression [47], to improve the accuracy of the analysis results. It will also make the V(D)J analysis more realistic due to the order of magnitude increase in high-throughput data.

Interestingly, we found two raccoon dogs with severe encephalitis during sampling, so we compared the differences in immunoglobulin expression between healthy and diseased raccoon dogs. Our results showed that the types of immunoglobulins expressed in the normal and diseased groups tended to be the same, but the amount of expressed genes differed between types of expression. This difference was mainly reflected in the fact that the types with higher expression in the normal group were usually reduced in the diseased group, while the types with lower expression in the normal group were elevated in the diseased group. This suggested that raccoon dogs do not increase their expression of immunoglobulin types when stimulated by antigens, and that the organism fights external antigens by increasing the expression of immunoglobulin types that were expressed in lower levels under normal conditions.

In addition, it should be noted that all the experimental animals we selected were injected with the same vaccine, and as of this writing, the effect of the vaccine on the immunogenetic aspects of the animal organism has not been reported, but according to our understanding, the injection of the vaccine increases the amount of the antibody repertoire expression but does not change the type of antibody expression. In this study, there was no significant difference between our diseased group of raccoon dog and the normal group, which also proves our above speculation.

Conclusions

In conclusion, by systematically analyzing the raccoon dog Ig gene loci structure and its expression characteristics, we hope that this study will provide potential theoretical support for raccoon dog breeding as well as raccoon dog immunity research.

Data availability

Sequence data that support the findings of this study have been deposited in the NCBI (https://www.ncbi.nlm.nih.gov/) with the primary accession code PRJNA1060491.

Abbreviations

AID:

Activation-Induced Cytidine Deaminase

BCR:

B Cell Receptor

CDR:

Complementarity Determining Region

CSR:

Class Switch Recombination

DH/JH gene:

Diversity/Joining Heavy Gene

Jκ/Jλ gene:

/joining κ/λ gene

FR:

Frame Region

GCV:

Gene Conversion

IgH/L:

Immunoglobulin Heavy/Light Chain

Ig:

Immunoglobulin

NGS:

Next-Generation Sequencing

5’RACE:

Rapid Amplification of cDNA 5’ Ends

RAG:

Recombination Activating Genes

RSS:

Recombination Signal Sequences

SHM:

Somatic Hypermutation

V region:

Variable Region

VH/Vκ/Vλ:

Variable Region Heavy/κ/λ Chain

References

  1. Niiranen L, Makela KA, Dona A, Krumsiek J, Karhu T, Makinen MJ, Thalmann O, Saarela S, Herzig KH. Seasonal regulation of metabolism: the effect of wintertime fasting and autumnal fattening on key central regulators of metabolism and the metabolic profile of the raccoon dog (Nyctereutes Procyonoides). Int J Mol Sci 2021, 22(9).

  2. Mustonen AJ, Finnila MAJ, Puukka KS, Jamsa TJ, Saarakkala S, Tuukkanen JK, Nieminen TP. Raccoon dog model shows preservation of bone during prolonged catabolism and reduced physical activity. J Exp Biol. 2017;220(Pt 12):2196–202.

    PubMed  Google Scholar 

  3. Yang S, He Y, Chen X, Kalim U, Wang Y, Yang S, Qi H, Cheng H, Lu X, Wang X, et al. Viral metagenomics reveals diverse viruses in the feces samples of raccoon dogs. Front Vet Sci. 2021;8:693564.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Kauhala K, Kowalczyk R. Invasion of the raccoon dog Nyctereutes procyonoides in Europe: history of colonization, features behind its success, and threats to native fauna. Curr Zool. 2011;57(5):584–98.

    Article  PubMed  Google Scholar 

  5. Liu H, Li Z, Si H, Zhong W, Fan Z, Li G. Comparative analysis of the gut microbiota of the blue Fox (Alopex lagopus) and raccoon dog (Nyctereutes procyonoides). Arch Microbiol. 2020;202(1):135–42.

    Article  CAS  PubMed  Google Scholar 

  6. Lan T, Li H, Yang S, Shi M, Han L, Sahu SK, Lu Y, Wang J, Zhou M, Liu H, et al. The chromosome-scale genome of the raccoon dog: insights into its evolutionary characteristics. iScience. 2022;25(10):105117.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Sun Y, Huang T, Hammarstrom L, Zhao Y. The Immunoglobulins: new insights, implications, and applications. Annu Rev Anim Biosci. 2020;8:145–69.

    Article  CAS  PubMed  Google Scholar 

  8. Gibson WS, Rodriguez OL, Shields K, Silver CA, Dorgham A, Emery M, Deikus G, Sebra R, Eichler EE, Bashir A, et al. Characterization of the Immunoglobulin lambda chain locus from diverse populations reveals extensive genetic variation. Genes Immun. 2023;24(1):21–31.

    Article  CAS  PubMed  Google Scholar 

  9. Jin S, Sun Y, Liang X, Gu X, Ning J, Xu Y, Chen S, Pan L. Emerging new therapeutic antibody derivatives for cancer treatment. Signal Transduct Target Therapy. 2022;7(1):39.

    Article  CAS  Google Scholar 

  10. Gyorkei A, Johansen FE, Qiao SW. Systematic characterization of Immunoglobulin loci and deep sequencing of the expressed repertoire in the Atlantic Cod (Gadus morhua). BMC Genomics. 2024;25(1):663.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Yi X, Liu X, Sun X, Wang S. Structural profile and diversity of Immunoglobulin genes in the Arctic Fox. Vet J. 2025;309:106295.

    Article  CAS  PubMed  Google Scholar 

  12. Inoue T, Kurosaki T. Memory B cells. Nat Rev Immunol. 2024;24(1):5–17.

    Article  CAS  PubMed  Google Scholar 

  13. Kwak K, Akkaya M, Pierce SK. B cell signaling in context. Nat Immunol. 2019;20(8):963–9.

    Article  CAS  PubMed  Google Scholar 

  14. Fang YD, Xie F, Zhang WD, Zeng WW, Lu J, Cheng YJ, Wang WH. Age-dependent distribution of IgA and IgG antibody-secreting cells in the pharyngeal tonsil of the bactrian camel. Vet J. 2024;305:106131.

    Article  CAS  PubMed  Google Scholar 

  15. Zis P, Liampas A, Pozotou T, Parperis K, Artemiadis A, Hadjigeorgiou G. Immunoglobulin use for the management of painful peripheral neuropathy: A systematic review and Meta-Analysis. Pain Ther. 2022;11(4):1219–27.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Yi X, Qiu Y, Wang S, Sun X. Analysis of Immunoglobulin organization and complexity in Mink (Neovison vison). Dev Comp Immunol. 2024;160:105234.

    Article  CAS  PubMed  Google Scholar 

  17. Chi X, Li Y, Qiu X. V(D)J recombination, somatic hypermutation and class switch recombination of Immunoglobulins: mechanism and regulation. Immunology. 2020;160(3):233–47.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Steele EJ, Franklin A, Lindley RA. Somatic mutation patterns at Ig and Non-Ig loci. DNA Repair (Amst). 2024;133:103607.

    Article  CAS  PubMed  Google Scholar 

  19. Zhang Y, Li X, Ba Z, Lou J, Gaertner KE, Zhu T, Lin X, Ye AY, Alt FW, Hu H. Molecular basis for differential Igk versus Igh V(D)J joining mechanisms. Nature. 2024;630(8015):189–97.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Jeon BC, Kim YJ, Park AK, Song MR, Na KM, Lee J, An D, Park Y, Hwang H, Kim TD, et al. Dynamic O-GlcNAcylation governs long-range chromatin interactions in V(D)J recombination during early B-cell development. Cell Mol Immunol. 2025;22(1):68–82.

    Article  CAS  PubMed  Google Scholar 

  21. Wang YY, Zhang SX, Yang XR, Hwang JK, Zhan CZ, Lian CY, Wang C, Gui TT, Wang BB, Xie X, et al. Mesoscale DNA feature in antibody-coding sequence facilitates somatic hypermutation. Cell. 2023;186(10):2193–.

    Article  CAS  PubMed  Google Scholar 

  22. Vlasova AN, Saif LJ. Bovine immunology: implications for dairy cattle. Front Immunol. 2021;12:643206.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Pennell M, Rodriguez OL, Watson CT, Greiff V. The evolutionary and functional significance of germline Immunoglobulin gene variation. Trends Immunol. 2023;44(1):7–21.

    Article  CAS  PubMed  Google Scholar 

  24. Seo H, Hirota K, Ohta K. Molecular mechanisms of avian Immunoglobulin gene diversification and prospect for industrial applications. Front Immunol. 2024;15:1453833.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. McGrath JJC, Park J, Troxell CA, Chervin JC, Li L, Kent JR, Changrob S, Fu Y, Huang M, Zheng NY, et al. Mutability and hypermutation antagonize Immunoglobulin codon optimality. Mol Cell. 2025;85(2):430–e444436.

    Article  CAS  PubMed  Google Scholar 

  26. Cumbers SJ, Williams GT, Davies SL, Grenfell RL, Takeda S, Batista FD, Sale JE, Neuberger MS. Generation and iterative affinity maturation of antibodies in vitro using hypermutating B-cell lines. Nat Biotechnol. 2002;20(11):1129–34.

    Article  CAS  PubMed  Google Scholar 

  27. Kajita M, Okazawa T, Ikeda M, Todo K, Magari M, Kanayama N, Ohmori H. Efficient affinity maturation of antibodies in an engineered chicken B cell line DT40-SW by increasing point mutation. J Biosci Bioeng. 2010;110(3):351–8.

    Article  CAS  PubMed  Google Scholar 

  28. Kuramochi T, Igawa T, Tsunoda H, Hattori K. Humanization and simultaneous optimization of monoclonal antibody. Methods Mol Biol. 2019;1904:213–30.

    Article  CAS  PubMed  Google Scholar 

  29. Seo H, Masuda H, Asagoshi K, Uchiki T, Kawata S, Sasaki G, Yabuki T, Miyai S, Takahashi N, Hashimoto SI, et al. Streamlined human antibody generation and optimization by exploiting designed Immunoglobulin loci in a B cell line. Cell Mol Immunol. 2021;18(6):1545–61.

    Article  CAS  PubMed  Google Scholar 

  30. Wu ML, Zhao HD, Tang XQ, Zhao WX, Yi XH, Li Q, Sun XZ. Organization and complexity of the Yak (Bos Grunniens) Immunoglobulin loci. Front Immunol 2022, 13.

  31. Du LJ, Wang SH, Zhu YJ, Zhao HD, Basit A, Yu XH, Li QW, Sun XZ. Immunoglobulin heavy chain variable region analysis in dairy goats. Immunobiology. 2018;223(11):599–607.

    Article  CAS  PubMed  Google Scholar 

  32. Yu X, Du L, Wu M, Wu J, He S, Yuan T, Sun X. The analysis of organization and diversity mechanism in goat Immunoglobulin light chain gene loci. Immunobiology. 2020;225(2):151889.

    Article  CAS  PubMed  Google Scholar 

  33. Martin J, Ponstingl H, Lefranc MP, Archer J, Sargan D, Bradley A. Comprehensive annotation and evolutionary insights into the canine (Canis lupus familiaris) antigen receptor loci. Immunogenetics. 2018;70(4):223–36.

    Article  CAS  PubMed  Google Scholar 

  34. Zhang H, Liu Y, Yu B, Lu R. An optimized TRIzol-based method for isolating RNA from adipose tissue. Biotechniques. 2023;74(5):203–9.

    Article  CAS  PubMed  Google Scholar 

  35. Chueca LJ, Kochmann J, Schell T, Greve C, Janke A, Pfenninger M, Klimpel S. De Novo genome assembly of the raccoon dog (Nyctereutes procyonoides). Front Genet. 2021;12:658256.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Lefranc MP. Immunoglobulin and T cell receptor genes: IMGT((R)) and the birth and rise of immunoinformatics. Front Immunol. 2014;5:22.

    Article  PubMed  PubMed Central  Google Scholar 

  37. Lefranc MP, Pommie C, Ruiz M, Giudicelli V, Foulquier E, Truong L, Thouvenin-Contet V, Lefranc G. IMGT unique numbering for Immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev Comp Immunol. 2003;27(1):55–77.

    Article  CAS  PubMed  Google Scholar 

  38. Manso T, Folch G, Giudicelli V, Jabado-Michaloud J, Kushwaha A, Ngoune VN, Georga M, Papadaki A, Debbagh C, Pégorier P, et al. IMGT® databases, related tools and web resources through three main axes of research and development. Nucleic Acids Res. 2022;50(D1):D1262–72.

    Article  CAS  PubMed  Google Scholar 

  39. Alamyar E, Duroux P, Lefranc MP, Giudicelli V. IMGT((R)) tools for the nucleotide analysis of Immunoglobulin (IG) and T cell receptor (TR) V-(D)-J repertoires, polymorphisms, and IG mutations: IMGT/V-QUEST and IMGT/HighV-QUEST for NGS. Methods Mol Biol. 2012;882:569–604.

    Article  CAS  PubMed  Google Scholar 

  40. Li S, Lefranc MP, Miles JJ, Alamyar E, Giudicelli V, Duroux P, Freeman JD, Corbin VD, Scheerlinck JP, Frohman MA, et al. IMGT/HighV QUEST paradigm for T cell receptor IMGT clonotype diversity and next generation repertoire Immunoprofiling. Nat Commun. 2013;4:2333.

    Article  PubMed  Google Scholar 

  41. Xie J, Chen Y, Cai G, Cai R, Hu Z, Wang H. Tree visualization by one table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Res. 2023;51(W1):W587–92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Agrawal A, Schatz DG. RAG1 and RAG2 form a stable postcleavage synaptic complex with DNA containing signal ends in V(D)J recombination. Cell. 1997;89(1):43–53.

    Article  CAS  PubMed  Google Scholar 

  43. Schroeder HW Jr., Hillson JL, Perlmutter RM. Structure and evolution of mammalian VH families. Int Immunol. 1990;2(1):41–50.

    Article  PubMed  Google Scholar 

  44. Stanfield RL, Haakenson J, Deiss TC, Criscitiello MF, Wilson IA, Smider VV. The unusual genetics and biochemistry of bovine Immunoglobulins. Adv Immunol. 2018;137:135–64.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  45. Sun Y, Wang C, Wang Y, Zhang T, Ren L, Hu X, Zhang R, Meng Q, Guo Y, Fei J, et al. A comprehensive analysis of germline and expressed Immunoglobulin repertoire in the horse. Dev Comp Immunol. 2010;34(9):1009–20.

    Article  CAS  PubMed  Google Scholar 

  46. Deng Y, Wu F, Li Q, Yao L, Yang C, Ma L, Yao X, Li J. Annotation and characterization of Immunoglobulin loci and CDR3 polymorphism in water Buffalo (Bubalus bubalis). Front Immunol. 2024;15:1503788.

    Article  CAS  PubMed  Google Scholar 

  47. Flajnik MF. A cold-blooded view of adaptive immunity. Nat Rev Immunol. 2018;18(7):438–53.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Wang Y, Liu J, Burrows PD, Wang JY. B cell development and maturation. Adv Exp Med Biol. 2020;1254:1–22.

    Article  CAS  PubMed  Google Scholar 

  49. Georgiou G, Ippolito GC, Beausang J, Busse CE, Wardemann H, Quake SR. The promise and challenge of high-throughput sequencing of the antibody repertoire. Nat Biotechnol. 2014;32(2):158–68.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Qiu Y, Yi X, Tang X, Wei Y, Zhang B, Duan S, Wang S, Sun X. Differential analysis of Immunoglobulin gene expression pattern in chickens of distinct breeds and developmental periods. J Anim Sci 2024, 102.

  51. Fugmann SD, Lee AI, Shockett PE, Villey IJ, Schatz DG. The RAG proteins and V(D)J recombination: complexes, ends, and transposition. Annu Rev Immunol. 2000;18:495–527.

    Article  CAS  PubMed  Google Scholar 

  52. Koti M, Kataeva G, Kaushik AK. Organization of D(H)-gene locus is distinct in cattle. Dev Biol (Basel). 2008;132:307–13.

    CAS  PubMed  Google Scholar 

  53. Koti M, Kataeva G, Kaushik AK. Novel atypical nucleotide insertions specifically at VH-DH junction generate exceptionally long CDR3H in cattle antibodies. Mol Immunol. 2010;47(11–12):2119–28.

    Article  CAS  PubMed  Google Scholar 

  54. Ma L, Qin T, Chu D, Cheng X, Wang J, Wang X, Wang P, Han H, Ren L, Aitken R, et al. Internal duplications of DH, JH, and C region genes create an unusual IgH gene locus in cattle. J Immunol. 2016;196(10):4358–66.

    Article  CAS  PubMed  Google Scholar 

  55. Del Pozo-Yauner L, Herrera GA, Perez Carreon JI, Turbat-Herrera EA, Rodriguez-Alvarez FJ, Ruiz Zamora RA. Role of the mechanisms for antibody repertoire diversification in monoclonal light chain deposition disorders: when a friend becomes foe. Front Immunol. 2023;14:1203425.

    Article  PubMed  PubMed Central  Google Scholar 

  56. Danilova N, Bussmann J, Jekosch K, Steiner LA. The Immunoglobulin heavy-chain locus in zebrafish: identification and expression of a previously unknown isotype, Immunoglobulin Z. Nat Immunol. 2005;6(3):295–302.

    Article  CAS  PubMed  Google Scholar 

  57. Yi X, Qiu Y, Xie P, Wang S, Sun X. Molecular characterization and complexity of the Immunoglobulin repertoire in the silver-black Fox (Vulpes vulpes). BMC Vet Res. 2025;21(1):214.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  58. Lowden MJ, Lei EK, Hussack G, Henry KA. Applications of High-Throughput DNA sequencing to Single-Domain antibody discovery and engineering. Methods Mol Biol. 2023;2702:489–540.

    Article  CAS  PubMed  Google Scholar 

  59. Qiu Y, Jiang J, Yi X, Wang S, Sun X. Exploration of the differential expression patterns of Immunoglobulin heavy chain genes in horses and donkeys. Dev Comp Immunol. 2025;166:105360.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank professor Chao Xu (College of Animal Science and Technology, Jilin Agricultural University) for sample collection.

Funding

Project supported by National Forage Industry Technology System Program (CARS-34).

Author information

Authors and Affiliations

  1. College of Animal Science and Technology, Northwest A&F University, Yangling, 712100, China

    Xiaohua Yi & Xiaoqin Tang

  2. College of Grassland Agriculture, Northwest A&F University, Yangling, 712100, China

    Yanbo Qiu, Puhang Xie & Xiuzhu Sun

  3. College of Animal Science and Technology, Jilin Agricultural University, Changchun, 130112, China

    Chao Xu

  4. School of Medicine, Westlake University, Hangzhou, 310024, China

    Xiaohua Yi

Authors
  1. Xiaohua Yi
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Yanbo Qiu
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Xiaoqin Tang
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Puhang Xie
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Chao Xu
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Xiuzhu Sun
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

XHY, and YBQ analyzed the data; XHY wrote the manuscript; XHY, XQT carried out the experiment; XZS reviewed and edited the manuscript; XHY and XZS designed the experiment; CX provided the raccoon dog tissue samples. PHX reviewed and revised the manuscript and contributed to the sample collection. XZS funded this study. All authors contributed to the interpretation of the results and writing of the manuscript. All authors contributed to the article and approved the submitted version.

Corresponding author

Correspondence to Xiuzhu Sun.

Ethics declarations

Ethical approval

All experimental protocols involving raccoon dogs were carried out in compliance with the guidelines and regulations of the Animal Protection Laboratory Animal Regulations (2013) and approved by the Institutional Animal Care and Use Committee (IACUC) of Northwest A&F University, China (No: NWAFAC231219). Furthermore, all experiments were performed in accordance with the ARRIVE guidelines.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Supplementary Material 3

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Yi, X., Qiu, Y., Tang, X. et al. Immunoglobulin gene loci structure and diversity of raccoon dog (Nyctereutes procyonoides). BMC Genomics 26, 424 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12864-025-11574-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12864-025-11574-1

Keywords

BMC Genomics

ISSN: 1471-2164

Contact us